Sequence
ATGGCCACCGCGGTGAGGGTAATCACCAAGTGGGGCCACCCCACCGCGGACATCACCCACCTCGTTGTCTCCACTAACGCCGGCGCCCACTCCCTTGGGACCGACGAGTGGCTCGCGGCACTCCTCGGCCTCCGTGCCACCGTCCAACGCACCATCCTCTACATGCACGGCTGCTCCGCCAGCTGCAGCGCGCTTCGCCTCACCAAGGACATCGCCGAGAACAACCACGGGGCGCGCGTGCTCGTGGCCTGCACGGAGGTCTTCCTCATAGTGTTCGCCGCCCCCGACAAGGCCCACCTTGACACCCTCGTCACGCATTGCCATTTGTGTAATGCTGTTAACTACAAACCTGACTGA

Curcuminoid synthase (CUS) is a type III polyketide synthase, a class defined by the absence of acyl carrier protein (ACP) domains and by the direct use of CoA-activated substrates. CUS mediates the stepwise assembly of curcuminoids by first catalyzing a decarboxylative condensation between malonyl-CoA and an aromatic CoA thioester such as feruloyl-CoA, yielding a diketide-CoA that is hydrolyzed to the corresponding β-keto acid. This β-keto acid is then employed as an extender unit in a second decarboxylative condensation with feruloyl-CoA, completing the biosynthesis of curcumin [349].

Gene size:
Protein size:
Reactions R9434 and R11858
Compounds affected curcumin

Databases
EraGene: 2197914
NCBI RefSeq: XM_015783169.1