Sequence
atgattaatgacatgcatccttctttaattaaagataaagatatagtagatgacgtaatgctacgtagctgtaaaatcattgcaatgaaagttatgccagacaaagttatgcaagttatggtgactgtattaatgcatgatggcgtatgtgaagaaatgcttttgaaatggaatctgctagacaatagaggcatggcgatttataaagttctgatggaagcgctttgcgctaagaaagatgtgaaaattagcaccgtaggaaaagtaggtcctctcggctgcgattacattaattgcgtagaaatctctatgtaa
CipA is a large cell-surface adhesin anchored in the outer membrane, facilitating attachment to both abiotic surfaces and neighboring cells. Its architecture is modular and elongated, enabling it to function as a structural scaffold that presents multiple binding interfaces for partner proteins, including CipB. In metabolic engineering, the CipA–CipB pair can be repurposed as a scaffold–ligand system capable of organizing sequential enzymes in close proximity, thereby creating a channel-like arrangement that promotes efficient transfer of intermediates between consecutive catalytic steps [340].
| Gene size: | |
| Protein size: | |
| Compounds affected | L-histidine |
Databases
| EraGene: | 2197877 |
|---|---|
| KEGG: | plu:plu1576 |