Sequence
atgattaatgacatgcatccttctttaattaaagataaagatatagtagatgacgtaatgctacgtagctgtaaaatcattgcaatgaaagttatgccagacaaagttatgcaagttatggtgactgtattaatgcatgatggcgtatgtgaagaaatgcttttgaaatggaatctgctagacaatagaggcatggcgatttataaagttctgatggaagcgctttgcgctaagaaagatgtgaaaattagcaccgtaggaaaagtaggtcctctcggctgcgattacattaattgcgtagaaatctctatgtaa

CipA is a large cell-surface adhesin anchored in the outer membrane, facilitating attachment to both abiotic surfaces and neighboring cells. Its architecture is modular and elongated, enabling it to function as a structural scaffold that presents multiple binding interfaces for partner proteins, including CipB. In metabolic engineering, the CipA–CipB pair can be repurposed as a scaffold–ligand system capable of organizing sequential enzymes in close proximity, thereby creating a channel-like arrangement that promotes efficient transfer of intermediates between consecutive catalytic steps [340].

Gene size:
Protein size:
Compounds affected L-histidine

Databases
EraGene: 2197877
KEGG: plu:plu1576